Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a to...
Saved in:
Main Author: | |
---|---|
Format: | Final Year Project Report |
Language: | English |
Published: |
Universiti Malaysia Sarawak, (UNIMAS)
2016
|
Subjects: | |
Online Access: | http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf http://ir.unimas.my/id/eprint/15463/ |
Tags: |
Add Tag
No Tags, Be the first to tag this record!
|
id |
my.unimas.ir.15463 |
---|---|
record_format |
eprints |
spelling |
my.unimas.ir.154632023-12-11T06:53:18Z http://ir.unimas.my/id/eprint/15463/ Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR Intan Syahirah, Amran QR Microbiology Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a tool. A total of 70 samples were obtained from the culture collection in Microbiology Laboratory FRST, UNIMAS. The samples was cultured into semi solid EMJH media added with 5-fluorouracil. The cultures were incubated at room temperature (28-30°C) for 30 days before ERIC-PCR was conducted. This procedure was used a specific primer which is ERIC 1 (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) that targeting ERIC sequence. The ERIC elements were used as a genetic marker to characterize isolates within bacterial species. Though, by using PyElph 1.4 software to construct the phylogenetic tree to know the similarity coefficient levels and calculating by using DI (Diversity Indices'). From that, there are no proper arrangement of bacteria in the group regardless of samples type whether it mix together to 7 groups and also of Leptospira in different location and sources. In conclusion, genetic relatedness between Leptospira spp are studied and allow their characterization among the type of samples isolates. Universiti Malaysia Sarawak, (UNIMAS) 2016 Final Year Project Report NonPeerReviewed text en http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf Intan Syahirah, Amran (2016) Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR. [Final Year Project Report] (Unpublished) |
institution |
Universiti Malaysia Sarawak |
building |
Centre for Academic Information Services (CAIS) |
collection |
Institutional Repository |
continent |
Asia |
country |
Malaysia |
content_provider |
Universiti Malaysia Sarawak |
content_source |
UNIMAS Institutional Repository |
url_provider |
http://ir.unimas.my/ |
language |
English |
topic |
QR Microbiology |
spellingShingle |
QR Microbiology Intan Syahirah, Amran Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
description |
Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public
health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing
of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a tool.
A total of 70 samples were obtained from the culture collection in Microbiology Laboratory FRST,
UNIMAS. The samples was cultured into semi solid EMJH media added with 5-fluorouracil. The
cultures were incubated at room temperature (28-30°C) for 30 days before ERIC-PCR was conducted.
This procedure was used a specific primer which is ERIC 1 (ATGTAAGCTCCTGGGGATTCAC)
and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) that targeting ERIC sequence. The ERIC
elements were used as a genetic marker to characterize isolates within bacterial species. Though, by
using PyElph 1.4 software to construct the phylogenetic tree to know the similarity coefficient levels
and calculating by using DI (Diversity Indices'). From that, there are no proper arrangement of
bacteria in the group regardless of samples type whether it mix together to 7 groups and also of
Leptospira in different location and sources. In conclusion, genetic relatedness between Leptospira
spp are studied and allow their characterization among the type of samples isolates. |
format |
Final Year Project Report |
author |
Intan Syahirah, Amran |
author_facet |
Intan Syahirah, Amran |
author_sort |
Intan Syahirah, Amran |
title |
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
title_short |
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
title_full |
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
title_fullStr |
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
title_full_unstemmed |
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR |
title_sort |
molecular characterization of lepotospira isolates from rodents, soil, and water in sarawak using eric-pcr |
publisher |
Universiti Malaysia Sarawak, (UNIMAS) |
publishDate |
2016 |
url |
http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf http://ir.unimas.my/id/eprint/15463/ |
_version_ |
1787140474369212416 |
score |
13.18916 |